[IGBF-3924] Investigate: Metacerberus .gff output causing error in IGB - JIRA UNCC

Details

Type: Task
Status: Closed (View Workflow)
Priority: Major
Resolution: Done
Affects Version/s: None
Fix Version/s: None
Labels:
None

Story Points:
1
Epic Link:
Publish our work
Sprint:
Fall 2

Description

Situation: Dr. Rick White has asked us to create some documentation for visualizing the output of his program Metacerberus in IGB. I've been working with his student Joshua Hensley to obtain sample output to test in IGB, but currently half of the .gff files being output by the program are throwing errors when they're loaded into IGB.

Here are the first few lines of the error messages:

10:44:46.743 ERROR c.a.genometry.thread.CThreadWorker - class com.affymetrix.genometry.symloader.GFF3 cannot be cast to class com.affymetrix.genometry.quickload.QuickLoadSymLoader (com.affymetrix.genometry.symloader.GFF3 and com.affymetrix.genometry.quickload.QuickLoadSymLoader are in unnamed module of loader org.apache.felix.framework.BundleWiringImpl$BundleClassLoader @2f4b02c6)
java.lang.ClassCastException: class com.affymetrix.genometry.symloader.GFF3 cannot be cast to class com.affymetrix.genometry.quickload.QuickLoadSymLoader (com.affymetrix.genometry.symloader.GFF3 and com.affymetrix.genometry.quickload.QuickLoadSymLoader are in unnamed module of loader org.apache.felix.framework.BundleWiringImpl$BundleClassLoader @2f4b02c6)
	at com.affymetrix.igb.view.load.GeneralLoadUtils$3.runInBackground(GeneralLoadUtils.java:1041)
	at com.affymetrix.igb.view.load.GeneralLoadUtils$3.runInBackground(GeneralLoadUtils.java:1020)
	at com.affymetrix.genometry.thread.CThreadWorker.doInBackground(CThreadWorker.java:73)
	at java.desktop/javax.swing.SwingWorker$1.call(SwingWorker.java:305)
	at java.base/java.util.concurrent.FutureTask.run(FutureTask.java:317)
	at java.desktop/javax.swing.SwingWorker.run(SwingWorker.java:342)
	at java.base/java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1144)
	at java.base/java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:642)
	at java.base/java.lang.Thread.run(Thread.java:1583)

Task: Investigate why some of the .gff files output by Metacerberus are throwing errors when being loaded into IGB 10.1.0.

Files which are throwing the above error:

prodigal_Lambda_phage_sequences.gff
FragGeneScan_Lambda_phage_sequences.gff

Link to Metacerberus output on Google Drive: https://drive.google.com/drive/folders/14noPsmKYMxX9jgHYQhkjqaTGzT8z8bSK
Link to file on Loraine Lab Google Drive: https://drive.google.com/drive/folders/1MLsVItXNcskfiCAg62GFmxWc1-NR40Tx?usp=drive_link

Attachments

Issue Links

blocks

IGBF-3884 Create documentation for MetaCerberus

Closed

relates to

IGBF-3927 Investigate: GFF parser error

Closed

Activity

Ascending order - Click to sort in descending order

Paige Kulzer created issue - 27/Sep/24 11:29 AM

Paige Kulzer made changes - 27/Sep/24 11:29 AM

Field	Original Value	New Value
Epic Link		IGBF-2809 [ 19325 ]

Paige Kulzer made changes - 27/Sep/24 11:29 AM

Link

This issue blocks ~~IGBF-3884~~ [ ~~IGBF-3884~~ ]

Nowlan Freese made changes - 01/Oct/24 2:40 PM

Status

To-Do [ 10305 ]

In Progress [ 3 ]

Paige Kulzer made changes - 01/Oct/24 3:20 PM

Assignee

Nowlan Freese [ nfreese ]

Paige Kulzer [ pkulzer ]

Hide

Permalink

Paige Kulzer added a comment - 01/Oct/24 3:28 PM - edited

These Lambda_phase_sequences.gff files have a ##FASTA section at the bottom that contains the complete fasta sequence of the lambda phage genome. Here's a subset of one of the files showing this section:

...
NC_001416.1	pyrodigal_v3.5.1	CDS	43224	43889	3.1	+	0	ID=NC_001416.1_37;Name=pphB; serine/threonine protein phosphatase 2;Alias=K07314;Dbxref=KOFam_all_FOAM;evalue=1.3e-72;product_start=3;product_end=216;product_length=213
NC_001416.1	pyrodigal_v3.5.1	CDS	43934	44509	23.6	+	0	ID=NC_001416.1_38;Name=Hypothetical;Alias=;Dbxref=;evalue=;product_start=;product_end=;product_length=
NC_001416.1	pyrodigal_v3.5.1	CDS	45966	46427	24.7	+	0	ID=NC_001416.1_39;Name=Prophage endopeptidase;Alias=K14744;Dbxref=KOFam_all_KEGG;evalue=2.9e-59;product_start=1;product_end=152;product_length=151
NC_001416.1	pyrodigal_v3.5.1	CDS	47042	47575	6.7	-	0	ID=NC_001416.1_40;Name=Hypothetical;Alias=;Dbxref=;evalue=;product_start=;product_end=;product_length=
NC_001416.1	pyrodigal_v3.5.1	CDS	47738	47944	10.2	+	0	ID=NC_001416.1_41;Name=Hypothetical;Alias=;Dbxref=;evalue=;product_start=;product_end=;product_length=
##FASTA
>NC_001416.1 |Enterobacteria phage lambda, complete genome
GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCG
TTCTTCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAGGAAACG
ACAGGTGCTGAAAGCGAGGCTTTTTGGCCTCTGTCGTTTCCTTTCTCTGTTTTTGTCCGT
GGAATGAACAATGGAAGTCAACAAAAAGCAGCTGGCTGACATTTTCGGTGCGAGTATCCG
TACCATTCAGAACTGGCAGGAACAGGGAATGCCCGTTCTGCGAGGCGGTGGCAAGGGTAA
...

While this is a valid component of a .gff file (see https://gmod.org/wiki/GFF3), and while IGB does currently have the logic to parse this ##FASTA section, it's not doing so consistently based on the first line of the fasta (see ~~IGBF-3927~~) and has thus been throwing the reported error.

I think the easiest way forward in terms of documentation will be to provide a caveat about this current limitation, then provide a way for readers to work around the problem (i.e., delete everything in those files from ##FASTA down) and mention that we will be working on fixing this issue.

Closing this ticket now!

Show

Paige Kulzer added a comment - 01/Oct/24 3:28 PM - edited These Lambda_phase_sequences.gff files have a ##FASTA section at the bottom that contains the complete fasta sequence of the lambda phage genome. Here's a subset of one of the files showing this section: ... NC_001416.1 pyrodigal_v3.5.1 CDS 43224 43889 3.1 + 0 ID=NC_001416.1_37;Name=pphB; serine/threonine protein phosphatase 2;Alias=K07314;Dbxref=KOFam_all_FOAM;evalue=1.3e-72;product_start=3;product_end=216;product_length=213 NC_001416.1 pyrodigal_v3.5.1 CDS 43934 44509 23.6 + 0 ID=NC_001416.1_38;Name=Hypothetical;Alias=;Dbxref=;evalue=;product_start=;product_end=;product_length= NC_001416.1 pyrodigal_v3.5.1 CDS 45966 46427 24.7 + 0 ID=NC_001416.1_39;Name=Prophage endopeptidase;Alias=K14744;Dbxref=KOFam_all_KEGG;evalue=2.9e-59;product_start=1;product_end=152;product_length=151 NC_001416.1 pyrodigal_v3.5.1 CDS 47042 47575 6.7 - 0 ID=NC_001416.1_40;Name=Hypothetical;Alias=;Dbxref=;evalue=;product_start=;product_end=;product_length= NC_001416.1 pyrodigal_v3.5.1 CDS 47738 47944 10.2 + 0 ID=NC_001416.1_41;Name=Hypothetical;Alias=;Dbxref=;evalue=;product_start=;product_end=;product_length= ##FASTA >NC_001416.1 |Enterobacteria phage lambda, complete genome GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCG TTCTTCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAGGAAACG ACAGGTGCTGAAAGCGAGGCTTTTTGGCCTCTGTCGTTTCCTTTCTCTGTTTTTGTCCGT GGAATGAACAATGGAAGTCAACAAAAAGCAGCTGGCTGACATTTTCGGTGCGAGTATCCG TACCATTCAGAACTGGCAGGAACAGGGAATGCCCGTTCTGCGAGGCGGTGGCAAGGGTAA ... While this is a valid component of a .gff file (see https://gmod.org/wiki/GFF3 ), and while IGB does currently have the logic to parse this ##FASTA section, it's not doing so consistently based on the first line of the fasta (see IGBF-3927 ) and has thus been throwing the reported error. I think the easiest way forward in terms of documentation will be to provide a caveat about this current limitation, then provide a way for readers to work around the problem (i.e., delete everything in those files from ##FASTA down) and mention that we will be working on fixing this issue. Closing this ticket now!