Situation: The GFF3 file format may include a Sequence Section in FASTA format at the end of the file, but IGB is not currently able to parse a GFF3 file when this section is present. See IGBF-3924 for a report on the resulting error when a GFF3 file with this section is loaded into IGB.

Here's some more info from the GFF3 documentation - https://gmod.org/wiki/GFF3

GFF3 Sequence Section
GFF3 files can also include sequence in FASTA format at the end of the file. The FASTA sequences are preceded by a ##FASTA line. This sequence section is optional. If present, the sequence section can define sequence for any landmark used in column 1 (the frame of reference). For example:

##gff-version 3
ctg123 . exon            1300  1500  .  +  .  ID=exon00001
ctg123 . exon            1050  1500  .  +  .  ID=exon00002
ctg123 . exon            3000  3902  .  +  .  ID=exon00003
ctg123 . exon            5000  5500  .  +  .  ID=exon00004
ctg123 . exon            7000  9000  .  +  .  ID=exon00005
##FASTA
>ctg123
cttctgggcgtacccgattctcggagaacttgccgcaccattccgccttg
tgttcattgctgcctgcatgttcattgtctacctcggctacgtgtggcta
tctttcctcggtgccctcgtgcacggagtcgagaaaccaaagaacaaaaa
aagaaattaaaatatttattttgctgtggtttttgatgtgtgttttttat
aatgatttttgatgtgaccaattgtacttttcctttaaatgaaatgtaat
cttaaatgtatttccgacgaattcgaggcctgaaaagtgtgacgccattc
...

When the GFF3 file is processed the IDs on the header line of FASTA entries are matched with IDs used in column 1 in the annotation section of the file.

You don’t have to store the FASTA in the GFF file. You can also store your sequences in a separate file containing only FASTA entries.

Task: Upgrade the GFF parser logic to be able to handle GFF3 files with a Sequence Section.

Example files which are not being parsed correctly:

• prodigal_Lambda_phage_sequences.gff
• FragGeneScan_Lambda_phage_sequences.gff

Link to those files on Google Drive: https://drive.google.com/drive/folders/14noPsmKYMxX9jgHYQhkjqaTGzT8z8bSK
Link to files on Loraine Lab Google Drive: https://drive.google.com/drive/folders/1MLsVItXNcskfiCAg62GFmxWc1-NR40Tx?usp=drive_link